European journal of Pharmacology

Xanthohumol attenuates isoprenaline-induced cardiac hypertrophy and fibrosis through regulating PTEN/AKT/mTOR pathway

Tao-Li Sun, Wen-Qun Li, Xiao-Liang Tong, Xin-Yi Liu, Wen-Hu Zhou

To appear in: European Journal of Pharmacology

Received Date: 15 August 2020
Revised Date: 12 October 2020
Accepted Date: 26 October 2020

Please cite this article as: Sun, T.-L., Li, W.-Q., Tong, X.-L., Liu, X.-Y., Zhou, W.-H., Xanthohumol attenuates isoprenaline-induced cardiac hypertrophy and fibrosis through regulating PTEN/AKT/mTOR pathway, European Journal of Pharmacology (2020)

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier B.V.

Title

Xanthohumol attenuates isoprenaline-induced cardiac hypertrophy and fibrosis through regulating PTEN/AKT/mTOR pathway
Authors

Tao-Li Sun, Wen-Qun Li, Xiao-Liang Tong, Xin-Yi Liu, Wen-Hu Zhou

CRediT authorship contribution statement

Sun Taoli: Conceptualization, Methodology, Software. Li Wenqun: Data curation, Writing-Original draft preparation. Tong Xiaoliang: Visualization, Investigation. Liu Xinyi: Methodology. Zhou Wenhu: Supervision, Writing- Reviewing and Editing.

Xanthohumol attenuates isoprenaline-induced cardiac hypertrophy and fibrosis through regulating PTEN/AKT/mTOR pathway

Tao-Li Suna, b *, Wen-Qun Lic, Xiao-Liang Tongd, Xin-Yi Liuc,
Wen-Hu Zhou a, b *
a College of Pharmacy, Changsha Medical University, Changsha, 410219,
China

bKey Laboratory Breeding Base of Hu’nan Oriented Fundamental and Applied Research of Innovative Pharmaceutics, Changsha Medical University, Changsha, 410219, China
c Department of Pharmacy, The Second Xiangya Hospital, Central South University, Changsha, 410011, China
d Department of Dermatology, The Third Xiangya Hospital, Central South University, Changsha, 410013 , China
*Corresponding author. E-mail addresses:
[email protected] (T, -L. Sun), [email protected] (W,-H. Zhou)

ABSTRACT

Emerging evidence suggests the cardiovascular protective effects of Xanthohumol (Xn), a prenylated flavonoid isolated from the hops (Humulus lupulus L.). However, the cardioprotective effect of Xn remains unclear. Present study aimed to investigate the protective role of Xn against isoprenaline (ISO)-induced cardiac hypertrophy and fibrosis, and elucidate the underlying mechanism. The cardiac hypertrophy and
fibrosis model were established via subcutaneously administration of ISO. ISO reduced the left ventricular contractile function and elevated myocardial enzyme levels, suggesting cardiac dysfunction. Moreover, the increased cardiac myocyte area, heart weight/body weight (HW/BW)
ratio and ANP/BNP expressions indicated the ISO-induced hypertrophy, while the excessive collagen-deposition and up-regulation of fibrosis marker protein (α-SMA, Collagen-I/III) expression indicated the
ISO-induced fibrosis. The ISO-induced cardiac dysfunction, hypertrophy and fibrosis were significantly attenuated by oral administrated with Xn. PTEN/AKT/mTOR pathway has been reported to involve in pathogenesis of cardiac hypertrophy and fibrosis. We found that Xn administration
up-regulated PTEN expression and inhibited the phosphorylation of AKT/mTOR in ISO-treated mice. Moreover, treating with VO-ohpic, a specific PTEN inhibitor, abolished the cardioprotective effect of Xn.
Collectively, these results suggested that Xn attenuated ISO-induced cardiac hypertrophy and fibrosis through regulating PTEN/AKT/mTOR pathway.
Keywords: Xanthohumol; Cardiac hypertrophy; Cardiac fibrosis; Isoprenaline; PTEN/AKT/mTOR pathway

1. Introduction

Cardiovascular diseases are the major public health concerns with high mortality and morbidity. Despite tremendous progress have been made, the global cardiovascular epidemic continues relentlessly. The WHO information indicated that about 17.1 million people died from cardiovascular diseases in 2004, representing 29% of all global deaths, and an estimated 23.6 million people will die from cardiovascular diseases each year by 2030 (Cui et al., 2011). Cardiac remodeling is viewed as the common pathological process that occurred in many cardiovascular diseases including myocardial infarction, hypertension, aortic stenosis, myocarditis and idiopathic dilated cardiomyopathy.
Although cardiac remodeling initially is regarded as the compensatory response to increased cardiac stress, which if untreated, eventually results in heart failure and sudden death (Saucerman et al., 2019). Cardiac hypertrophy and fibrosis are the main typical pathological features of cardiac remodeling (Gibb and Hill, 2018). Therefore, attenuating cardiac hypertrophy and fibrosis is important to identify new therapeutic options for treating cardiovascular diseases.
Xanthohumol (Xn), the most abundant prenylated flavonoid with

0.1-1% of dry weight in hops (Humulus lupulus L.), exhibits a wide range of beneficial pharmacological properties, including anticancer, antibacterial, antiviral, antifungal, and antiplasmodial activity (Jiang et al.,

2018). Growing evidences have shown the cardiovascular protective effects of Xn. For example, Xn inhibited arrhythmia via regulating calcium signaling in rat ventricular myocytes (Arnaiz-Cot et al., 2017). Recently, Silva et al. found that Xn-fortified beer intake resulted in a significant attenuation of the pulmonary vascular remodeling (Silva et al., 2019). These studies prompt us to further investigate the effect of Xn on cardiac hypertrophy and fibrosis. The PTEN/AKT/mTOR pathway is a major signaling axis downstream of growth factor receptor tyrosine kinases, which has been reported to involve in pathogenesis of cardiac hypertrophy and fibrosis (Shi et al., 2019; Wei et al., 2020). It has been documented that the reduced Akt phosphorylation mediated the antiangiogenic and anti-lymphocytic leukemia activity of Xn (Benelli et al., 2012; Dell’Eva et al., 2007). However, whether Xn regulates PTEN/AKT/mTOR pathway in heart and thus attenuates cardiac hypertrophy and fibrosis remains unknown.
Isoprenaline (ISO)-induced cardiac hypertrophy and fibrosis is a dependable, consistent and well characterized model with advancement to heart failure (Krenek et al., 2009). Therefore, present study aimed to explore the effect of Xn on ISO-induced cardiac hypertrophy and fibrosis in vivo, and determined the underlying mechanism whether involved PTEN/AKT/mTOR pathway.

2. Material and methods

2.1 Animal and procedures

Male C57BL/6 mice (6-8 weeks-old, 20-25g) were treated and cared for in accordance with the National Institutes of Health Guide (NIH publications № 8023). These animals were purchased from Laboratory Animal Center, Xiangya School of Medicine, Central South University (Changsha, China), and approved by the Medicine Animal Welfare Committee of Xiangya School of Medicine (SYXK-2015/0017).
The first batch of mice were randomly divided into four groups (n=8 mice in each group): (1) Control group; (2) ISO group; (3) ISO +Xn (L) group; (4) ISO + Xn (H) group. The mice in ISO group were subcutaneously injected with ISO (5 mg/kg, twice a day) for 14 days. Xn was obtained from Nanjing Spring &Autumn Biological Engineering Co., Ltd (Nanjing, China), which was dissolved in 0.5% sodium carboxymethyl cellulose by ultrasound. Mice in the ISO + Xn (L) and ISO + Xn (H) groups were administrated with Xn 1 mg/kg/day and 5 mg/kg/day for 14 days by oral gavage, respectively. Both the control and ISO groups were orally administrated isovolumic 0.5% sodium carboxymethyl cellulose. The second batch of mice were randomly divided into three groups (n=8 mice in each group): (1) ISO group; (2) ISO + Xn group; (3) ISO + Xn + VO-ohpic group. These mice were subcutaneously injected with ISO and orally administrated with Xn at

dose of 5 mg/kg daily in the presence or absence of VO-ohpic (specific PTEN inhibitor, 10 mg/kg/day, i.p.) for 14 days.
After completing these experiments mentioned above, the mice were anesthetized with isoflurane for echocardiography detection. The blood and heart samples were collected immediately.
2.2. Echocardiography analysis

Transthoracic echocardiography was conducted through a 30 MHz probe (Vevo 1100 system; VisualSonics, Canada) as previously described (Chen et al., 2019). The indices reflecting left ventricular contractile function, such as left ventricular ejection fraction (EF%) and left ventricular fractional shortening (FS%), were calculated.
2.3. Myocardial enzyme analysis

The collected blood samples were centrifuged at 3000 rpm (1006.2 g) in 4°C for 15 min to obtain plasma. The myocardial enzyme including cardiac troponin T (cTnT) and Creatine Kinase (CK) were analyzed by using kits with an automatic biochemical analyzer (Abbott
Pharmaceutical Co., Ltd., Lake Bluff, IL, USA). The experiments were performed according to the manufacturers’ instructions.
2.4. Histopathological analysis

The hearts were fixed with 4% paraformaldehyde solution and then embedded in paraffin. Collected 5 µm paraffin section were conducted with Hematoxylin-Eosin (HE) staining, Masson’s trichrome (Masson)

staining, Wheat Germ Agglutinin (WGA) staining and Sirius red staining according to the manufacturers’ instructions. HE staining, Masson staining and WGA staining were used to determine the morphology, collagen deposition and cardiac myocyte area, respectively. Sirius-Red staining was used for marking Collagen I (red or yellow) and Collagen III (green) by polarized light microscope. The immunohistochemical analysis was performed to determine the expression of α-SMA and Collagen I/III in myocardium. The images were analyzed using Image Pro Plus 3.0 (Nikon, Tokyo, Japan).
2.5. Western blotting analysis

Fresh myocardiums were lysed in RIPA buffer (containing 0.1% PMSF) (BOSTER Biological Technology; Wuhan, China). Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 8-10% gradient gels and transferred onto 0.45 μm polyvinylidene fluoride (PVDF) membranes. The expressions of target protein were normalized to the glyceraldehydes-3-phosphate dehydrogenase (GAPDH) protein. Antibodies against α-SMA(#19245), PTEN (#9188), p-AKT (#9271), AKT (#9272), p-mTOR (#5536), mTOR
(#2972), GAPDH (#2118) and horseradish peroxidase-linked anti-mouse or anti-rabbit IgG (#7074) were purchased from Cell Signaling Technology (Boston, USA).
2.6. Real-time PCR analysis

The total RNA extraction, reverse transcription and following quantitative analysis were conducted as described in our previous study (Li et al., 2019). PCR amplifications were quantified by using SYBR Green PCR Master Mix (Applied Biosystems) and normalized results against GAPDH gene expression. The sequences of all primers are presented in Table 1.
2.7. Statistical analysis

The results were presented as means ± S.E.M. Data comparison of two groups with normal distribution was performed by Two-tailed Student’s t-test, and multiple comparisons were performed by one-way ANOVA and two-way ANOVA followed by Tukey and Bonferroni post hoc tests, respectively. Results were considered statistically significant when P < 0.05.
3. Results

3.1 Effect of Xn on ISO-induced abnormal cardiac function and myocardial enzyme
The C57BL/6 mice were subcutaneously injected with ISO for 14 days to establish the cardiac dysfunction model. Echocardiography assessment showed that ISO reduced the left ventricular contractile function as indicated by the decreased EF% and FS% ( 1A-C).
Moreover, ISO induced significant elevation of myocardial enzyme levels

including CK and cTnT in plasma (1D and 1E). These results suggested the abnormal cardiac function and myocardial enzyme. To determine the cardioprotective effect of Xn, oral administration of Xn at dose of 1 or 5 mg/kg daily was conducted in ISO-treated mice for 14 days, and the cardiac function and myocardial enzyme levels were evaluated.
As shown in1A-E, Xn administration improved the left ventricular contractile function and reduced the myocardial enzyme levels in
ISO-treated mice, indicating that Xn attenuated ISO-induced abnormal cardiac function and myocardial enzyme.
3.2 Effect of Xn on ISO-induced cardiac hypertrophy

Cardiac hypertrophy is a typical pathological feature of cardiac remodeling, which occurred in multiple cardiovascular diseases. HE and WGA staining were used to evaluate the morphology and cardiac myocyte area, respectively. Results showed that Xn reversed irregularly arranged cardiac muscle fibers and decreased cardiac myocyte area in ISO-treated mice (2A and 2B). Heart weight/body weight (HW/BW) ratio further confirmed this finding (2C). ANP and BNP are well known hypertrophic markers. ISO induced up-regulation of ANP and BNP expressions in myocardium, which can be attenuated by Xn administration ( 2D), suggesting its protective effect against
ISO-induced cardiac hypertrophy.

3.3 Effect of Xn on ISO-induced cardiac fibrosis

Accompanying with cardiac hypertrophy, cardiac fibrosis was observed in the development of multiple cardiovascular diseases. The collagen deposition, a classic sign of cardiac fibrosis, was evaluated by Masson staining. Moreover, myofibroblasts differentiated from cardiac fibroblasts are regarded as the main cell type in fibrotic myocardium, and the hallmark of differentiation is α-smooth muscle actin (α-SMA). The results of Masson staining and α-SMA protein test showed that ISO promoted the collagen deposition and α-SMA protein expression
3A-B, 3C and 3F). In view of the fact that myocardial collagen deposition mainly refers to collagen types I and III, therefore their expressions were measured. As shown in 3A, 3D-E and 3G, both protein and mRNA expression of collagen I and III were increased in myocardium of
ISO-treated mice. These results, collectively, confirmed ISO-induced the cardiac fibrosis, and the pro-fibrosis effect of ISO was dramatically inhibited by Xn.
3.4 Effect of Xn on PTEN/AKT/mTOR pathway in ISO-treated mice

The PTEN/AKT/mTOR pathway plays a key role in ISO-induced cardiac hypertrophy and fibrosis. To determine the underlying mechanism, we investigated the effect of Xn on PTEN/AKT/mTOR pathway in
ISO-induced cardiac hypertrophy and fibrosis model. Results showed that Xn can reverse the ISO-induced down-regulation of PTEN at protein level. In view of the fact that PTEN involves cardiac hypertrophy in the

absence of mRNA level (Schwartzbauer and Robbins, 2001), we further determined the its mRNA expression. The result showed that both ISO and ISO+Xn treatments didn’t affect the PTEN mRNA expression (supplementary 1), suggesting the expression alteration of PTEN didn’t occur in transcriptional level. The PTEN has emerged as a critical regulator for AKT/mTOR pathway. We further found that ISO increased the expressions of p-AKT and p-mTOR, indicated the AKT and mTOR phosphorylation. The Xn administration up-regulated PTEN expression and inhibited the phosphorylation of AKT/mTOR in ISO-treated mice ( 4A-D). These results suggested that PTEN/AKT/mTOR pathway was involved in protective effect of Xn against ISO-induced cardiac hypertrophy and fibrosis.
3.5 Blocking of PTEN reduced Xn-mediated inhibitory effect on ISO-induced cardiac hypertrophy and fibrosis
To further determine the role of PTEN/AKT/mTOR pathway in the cardioprotective effect of Xn, mice were treated with PTEN specific inhibitor VO-ohpic in the presence of Xn for 14 days. As shown in5A-D, VO-ohpic treatment can reverse the up-regulation of PTEN and inhibition of AKT/mTOR phosphorylation induced by Xn. Xn attenuated ISO-induced abnormal cardiac function and myocardial enzyme levels, and these effects were also reversed by VO-ohpic co-treatment (
6A-E). Correspondingly, VO-ohpic abolished the protective effect of Xn

against ISO-induced cardiac hypertrophy (7A-C) and fibrosis (8A-G). Taken together, these results demonstrated that Xn prevented ISO-induced hypertrophy and fibrosis through regulating PTEN/AKT/mTOR pathway.
4. Discussion

As the second largest group of polyphenolic phytochemicals occurs in the human diet, flavonoids are naturally presented in a variety of fruit, vegetables, and plant-based food products (Mozaffarian and Wu, 2018). Epidemiological studies have shown a positive correlation between habitual intake of high flavonoid-rich foods and cardiovascular health.
Moreover, a large number of compelling experimental evidences indicate the protective role of flavonoids for cardiovascular diseases (Rees et al., 2018). For example, Quercetin is a typical polyphenolic flavonoid that has traditionally been used for the treatment of cardiovascular diseases (Batiha et al., 2020). The cardioprotective potential of Quercetin has been widely documented in different animal models including the ISO-induced cardiac hypertrophy and fibrosis (Ferenczyova et al., 2020). Thus, looking for cardioprotective candidate from flavonoids may be a novel approach for treating cardiovascular disease.
Xn is a prenylated flavonoid isolated from the hops (Humulus lupulus L.), which is also a constituent of beer with the concentrations up

to 0.96 mg/L (Chen et al., 2012). The previous studies on pharmacological properties of Xn mainly focused on its anticancer activity (Jiang et al., 2018). With in-depth study, the cardiovascular protective effects of Xn were gradually unveiled. Xn prevented thrombosis without increased bleeding risk by inhibiting platelet activation (Xin et al., 2017). Xn attenuated atherosclerosis by reducing arterial cholesterol content in CETP-transgenic mice (Hirata et al., 2012). Xn can suppress aberrant ryanodine receptor Ca2+ release in rat ventricular myocytes, exhibiting clinically desirable antiarrhythmic properties (Arnaiz-Cot et al., 2017). More recently, the beneficial effects of Xn on pulmonary vasculature and right ventricular function were observed in the experimental pulmonary arterial hypertension rats (Silva et al., 2019). In present study, we found that Xn reversed ISO-induced cardiac dysfunction with the increase of EF% and FS%. The decreased myocardial enzyme in plasma, including CK and cTnT, also indicated the improvement on cardiac function. ISO treatment increased the cross section of myocardial fiber, heart weight proportion and ANP/BNP expressions, suggesting cardiac hypertrophy. Moreover, collagen deposition, up-regulation of α-SMA and collagen indicated the
ISO-induced cardiac fibrosis. Moreover, Xn can prevent these pathological changes induced by ISO, indicating the protective role of Xn against ISO-induced cardiac hypertrophy and fibrosis. Encouraged by

these results, we further explored the mechanism underlying the cardioprotective effect of Xn.
It has been reported that Valproic acid attenuates sepsis-induced myocardial dysfunction in rats through the PTEN/AKT/mTOR pathway (Shi et al., 2019). The PTEN/AKT/mTOR pathway, a major signaling axis downstream of growth factor receptor tyrosine, has been intensely studied due to its role in a wide range of key pathological processes including the cardiac hypertrophy and fibrosis (Shi et al., 2019; Wei et al., 2020). Resveratrol suppressed chronic intermittent hypoxia-induced cardiac hypertrophy via targeting the PI3K/AKT/mTOR pathway (Guan et al., 2019). Moreover, the lipid phosphatase, PTEN, acted as an
endogenous negative regulator of the PI3K/Akt/mTOR pathway (Xu et al., 2014). Resveratrol can prevent PTEN down-regulation and attenuate cardiac hypertrophy after pressure overload (Chen et al., 2019).
Enhancement of PTEN stability prevented atrial fibrosis via inhibiting AKT signaling (Li et al., 2018). Therefore, targeting PTEN/AKT/mTOR pathway may be a novel treatment strategy for cardiovascular disease. In view of the facts that reduced AKT phosphorylation mediated the antiangiogenic and anti-lymphocytic leukemia activity of Xn (Benelli et al., 2012; Dell’Eva et al., 2007), we speculated that the inhibitory effect of Xn on cardiac hypertrophy and fibrosis may involve PTEN/AKT/mTOR pathway. The results showed that ISO induced PTEN down-regulation

and AKT/mTOR phosphorylation accompanied with cardiac hypertrophy and fibrosis, while Xn significantly up-regulated PTEN expression leading to AKT/mTOR inactivation. However, blocking PTEN activity by VO-ohpic abolished the protective effect of Xn against ISO-induced cardiac dysfunction, hypertrophy and fibrosis. Collectively, these results suggested that Xn attenuated ISO-induced cardiac hypertrophy and fibrosis through PTEN/AKT/mTOR pathway.
However, present study lacks in vitro experiment regarding the protective effect of Xn on cardiomyocyte hypertrophy and cardiac fibroblasts activation. PTEN is expressed in both cardiomyocyte and cardiac fibroblasts (Oudit et al., 2004), which cell type plays main role in the cardioprotective effect of Xn remains unknown. It has been reported that PTEN is responsible for regulating cancer cells proliferation and migration, and the proliferation of cardiac fibroblasts is the main pathological manifestations in heart disease. Therefore, further in vitro experiment regarding the cardioprotective effect of Xn may focus on the cardiac fibroblasts. In addition, it is well known that PTEN/AKT/mTOR pathway is a central regulating mechanism contributing to autophagy (Shi et al., 2019), therefore whether the cardioprotective effect of Xn involves autophagy deserves further investigation.
The first batch animal experiment (Con, ISO, ISO+Xn) has demonstrated the animal model is successful, which allowed us to

complete the second batch of animal experiment (ISO, ISO+Xn, ISO+Xn+VO-ohpic) without control group. However, the lack of a control group in the second batch of animals may be the limitations of present study. Moreover, the low dose of Xn (5 mg/kg/day) used in present study may raise doubt, thus the pharmacokinetics of Xn deserves attention. Human pharmacokinetics results showed that, following oral administration, Xn shows a linear response with increasing oral dose, and Xn has a distinct biphasic absorption pattern (Legette et al., 2014). Slow absorption after oral administration in human and enterohepatic recirculation contributes to long half-lives of Xn (van Breemen et al., 2014).
5. Conclusion

In conclusion, our present study investigated the cardioprotective effect of Xn for the first time, and demonstrated that Xn treatment significantly attenuated and reversed the ISO-induced cardiac hypertrophy and fibrosis. Mechanistically, the cardioprotective effect of Xn was mediated by up-regulating PTEN leading to AKT/mTOR inactivation as shown in  9. These findings provide a scientific basis supporting the cardiovascular protective activity of Xn, and suggest that Xn may be a novel therapeutic agent for treatment of cardiac dysfunction. Acknowledgments

This study was supported by grants of the Hunan Provincial Natural Scientific Foundation (No. 2018JJ3571, 2019JJ50849), National Natural Scientific Foundation of China (No. 81703518, 81673614) and Hunan Education Department Project (No. 17C0171).
CRediT authorship contribution statement

Sun Taoli: Conceptualization, Methodology, Software. Li Wenqun: Data curation, Writing-Original draft preparation. Tong Xiaoliang: Visualization, Investigation. Liu Xinyi: Methodology. Zhou Wenhu: Supervision, Writing- Reviewing and Editing.
Conflicts of Interest

The authors declare no conflict of interest.
References
Arnaiz-Cot, J.J., Cleemann, L., Morad, M., 2017. Xanthohumol Modulates Calcium Signaling in Rat Ventricular Myocytes: Possible Antiarrhythmic Properties. The Journal of pharmacology and experimental therapeutics 360, 239-248.
Batiha, G.E., Beshbishy, A.M., Ikram, M., Mulla, Z.S., El-Hack, M.E.A., Taha, A.E., Algammal, A.M., Elewa, Y.H.A., 2020. The Pharmacological Activity, Biochemical Properties, and Pharmacokinetics of the Major Natural Polyphenolic Flavonoid: Quercetin. Foods 9.
Benelli, R., Vene, R., Ciarlo, M., Carlone, S., Barbieri, O., Ferrari, N., 2012. The AKT/NF-kappaB inhibitor xanthohumol is a potent anti-lymphocytic leukemia drug overcoming chemoresistance and cell infiltration. Biochemical pharmacology 83, 1634-1642.
Chen, C., Zou, L.X., Lin, Q.Y., Yan, X., Bi, H.L., Xie, X., Wang, S., Wang, Q.S.,

Zhang, Y.L., Li, H.H., 2019. Resveratrol as a new inhibitor of immunoproteasome prevents PTEN degradation and attenuates cardiac hypertrophy after pressure overload. Redox biology 20, 390-401.
Chen, Q.H., Fu, M.L., Chen, M.M., Liu, J., Liu, X.J., He, G.Q., Pu, S.C., 2012.
Preparative isolation and purification of xanthohumol from hops (Humulus lupulus L.) by high-speed counter-current chromatography. Food chemistry 132, 619-623.
Cui, Z., Dewey, S., Gomes, A.V., 2011. Cardioproteomics: advancing the discovery of signaling mechanisms involved in cardiovascular diseases. American journal of cardiovascular disease 1, 274-292.
Dell’Eva, R., Ambrosini, C., Vannini, N., Piaggio, G., Albini, A., Ferrari, N., 2007. AKT/NF-kappaB inhibitor xanthohumol targets cell growth and angiogenesis in hematologic malignancies. Cancer 110, 2007-2011.
Ferenczyova, K., Kalocayova, B., Bartekova, M., 2020. Potential Implications of Quercetin and its Derivatives in Cardioprotection. International journal of molecular sciences 21.
Gibb, A.A., Hill, B.G., 2018. Metabolic Coordination of Physiological and Pathological Cardiac Remodeling. Circulation research 123, 107-128.
Guan, P., Sun, Z.M., Wang, N., Zhou, J., Luo, L.F., Zhao, Y.S., Ji, E.S., 2019.
Resveratrol prevents chronic intermittent hypoxia-induced cardiac hypertrophy by targeting the PI3K/AKT/mTOR pathway. Life sciences 233, 116748.
Hirata, H., Yimin, Segawa, S., Ozaki, M., Kobayashi, N., Shigyo, T., Chiba, H., 2012. Xanthohumol prevents atherosclerosis by reducing arterial cholesterol content via CETP and apolipoprotein E in CETP-transgenic mice. PloS one 7, e49415.
Jiang, C.H., Sun, T.L., Xiang, D.X., Wei, S.S., Li, W.Q., 2018. Anticancer Activity and Mechanism of Xanthohumol: A Prenylated Flavonoid From Hops (Humulus lupulus L.). Frontiers in pharmacology 9, 530.
Krenek, P., Kmecova, J., Kucerova, D., Bajuszova, Z., Musil, P., Gazova, A., Ochodnicky, P., Klimas, J., Kyselovic, J., 2009. Isoproterenol-induced heart failure in the rat is associated with nitric oxide-dependent functional alterations

of cardiac function. European journal of heart failure 11, 140-146.
Legette, L., Karnpracha, C., Reed, R.L., Choi, J., Bobe, G., Christensen, J.M., Rodriguez-Proteau, R., Purnell, J.Q., Stevens, J.F., 2014. Human pharmacokinetics of xanthohumol, an antihyperglycemic flavonoid from hops. Molecular nutrition & food research 58, 248-255.
Li, J., Wang, S., Bai, J., Yang, X.L., Zhang, Y.L., Che, Y.L., Li, H.H., Yang, Y.Z., 2018.
Novel Role for the Immunoproteasome Subunit PSMB10 in Angiotensin II-Induced Atrial Fibrillation in Mice. Hypertension 71, 866-876.
Li, W.Q., Tan, S.L., Li, X.H., Sun, T.L., Li, D., Du, J., Wei, S.S., Li, Y.J., Zhang, B.K.,
2019. Calcitonin gene-related peptide inhibits the cardiac fibroblasts senescence in cardiac fibrosis via up-regulating klotho expression. European journal of pharmacology 843, 96-103.
Mozaffarian, D., Wu, J.H.Y., 2018. Flavonoids, Dairy Foods, and Cardiovascular and Metabolic Health: A Review of Emerging Biologic Pathways. Circulation research 122, 369-384.
Oudit, G.Y., Sun, H., Kerfant, B.G., Crackower, M.A., Penninger, J.M., Backx, P.H., 2004. The role of phosphoinositide-3 kinase and PTEN in cardiovascular physiology and disease. Journal of molecular and cellular cardiology 37, 449-471.
Rees, A., Dodd, G.F., Spencer, J.P.E., 2018. The Effects of Flavonoids on Cardiovascular Health: A Review of Human Intervention Trials and Implications for Cerebrovascular Function. Nutrients 10.
Saucerman, J.J., Tan, P.M., Buchholz, K.S., McCulloch, A.D., Omens, J.H., 2019. Mechanical regulation of gene expression in cardiac myocytes and fibroblasts. Nature reviews. Cardiology 16, 361-378.
Schwartzbauer, G., Robbins, J., 2001. The tumor suppressor gene PTEN can regulate cardiac hypertrophy and survival. The Journal of biological chemistry 276, 35786-35793.
Shi, X., Liu, Y., Zhang, D., Xiao, D., 2019. Valproic acid attenuates sepsis-induced myocardial dysfunction in rats by accelerating autophagy through the

PTEN/AKT/mTOR pathway. Life sciences 232, 116613.
Silva, A.F., Faria-Costa, G., Sousa-Nunes, F., Santos, M.F., Ferreira-Pinto, M.J., Duarte, D., Rodrigues, I., Tiago Guimaraes, J., Leite-Moreira, A., Moreira-Goncalves, D., Henriques-Coelho, T., Negrao, R., 2019. Anti-Remodeling Effects of Xanthohumol-Fortified Beer in Pulmonary Arterial Hypertension Mediated by ERK and AKT Inhibition. Nutrients 11.
van Breemen, R.B., Yuan, Y., Banuvar, S., Shulman, L.P., Qiu, X., Alvarenga, R.F., Chen, S.N., Dietz, B.M., Bolton, J.L., Pauli, G.F., Krause, E., Viana, M., Nikolic, D., 2014. Pharmacokinetics of prenylated hop phenols in women following oral administration of a standardized extract of hops. Molecular nutrition & food research 58, 1962-1969.
Wei, L., Zhou, Q., Tian, H., Su, Y., Fu, G.H., Sun, T., 2020. Integrin beta3 promotes cardiomyocyte proliferation and attenuates hypoxia-induced apoptosis via regulating the PTEN/Akt/mTOR and ERK1/2 pathways. International journal of biological sciences 16, 644-654.
Xin, G., Wei, Z., Ji, C., Zheng, H., Gu, J., Ma, L., Huang, W., Morris-Natschke, S.L.,
Yeh, J.L., Zhang, R., Qin, C., Wen, L., Xing, Z., Cao, Y., Xia, Q., Li, K., Niu, H.,
Lee, K.H., Huang, W., 2017. Xanthohumol isolated from Humulus lupulus prevents thrombosis without increased bleeding risk by inhibiting platelet activation and mtDNA release. Free radical biology & medicine 108, 247-257.
Xu, X., Roe, N.D., Weiser-Evans, M.C., Ren, J., 2014. Inhibition of mammalian target of rapamycin with rapamycin reverses hypertrophic cardiomyopathy in mice with cardiomyocyte-specific knockout of PTEN. Hypertension 63, 729-739.

Table 1. Primers for the real-time polymerase chain reaction.

Gene Forward primer Reverse primer
ANP CGTCTTGGCCTTTTGGCTTC TACCGGCATCTTCTCCTCCA
BNP CGCTGGGAGGTCACTCCTAT TCCAGCAGCTGCATCTTGAA
Collagen-I CCTCAGGGTATTGCTGGACAAC CAGAAGGACCTTGTTTGCCAGG
Collagen-III ACGTAGATGAATTGGGATGCAG GGGTTGGGGCAGTCTAGTC
PTEN CCAGAGACAAAAAGGGAGTCACA TTCCGCCACTGAACATTGG
GAPDH CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG

Legends
1. Effect of Xn on ISO-induced abnormal cardiac function and myocardial enzyme.
2. Effect of Xn on ISO-induced cardiac hypertrophy.  3. Effect of Xn on ISO-induced cardiac fibrosis.
4. Effect of Xn on PTEN/AKT/mTOR signaling in ISO-treated mice.
5. VO-ohpic reversed the regulative effect of Xn on PTEN/AKT/mTOR pathway in ISO-treated mice.
6. VO-ohpic reduced Xn-mediated inhibitory effect on ISO-induced cardiac dysfunction.
7. VO-ohpic reduced Xn-mediated inhibitory effect on ISO-induced cardiac hypertrophy.
8. VO-ohpic reduced Xn-mediated inhibitory effect on ISO-induced cardiac fibrosis.
9. Summary scheme of mechanism underlying the protective effect of Xn against ISO-induced cardiac hypertrophy and fibrosis.
Supplementary  Effect of Xn on PTEN mRNA expression in ISO-treated mice

1. Effect of Xn on ISO-induced abnormal cardiac function and myocardial enzyme. (A) Representative M-mode echocardiography of left ventricular chamber; (B, C) Left ventricular ejection fraction (EF%) and left ventricular fractional shortening (FS%). (D, E) Levels of myocardial enzyme including CK and cTnT in plasma. Xn: Xanthohumol, ISO: Isoprenaline, CK: Creatine Kinase, cTnT: cardiac Troponin T. Xn (L): 1 mg/kg/day, Xn(H): 5 mg/kg/day. Date are mean±S.E.M. n=8.

**P < 0.01 vs. Control; #P < 0.05, ##P < 0.01 vs. ISO.

 2. Effect of Xn on ISO-induced cardiac hypertrophy. (A, B) Representative images of HE staining and WGA staining in myocardium; (C) heart weight/body weight ratio (HW/BW); (D) The mRNA expressions of ANP and BNP. ANP: natriuretic peptide type A, BNP: natriuretic peptide type B. Date are mean±S.E.M. n=8. **P < 0.01 vs. Control; #P < 0.05, ##P < 0.01 vs. ISO.

3. Effect of Xn on ISO-induced cardiac fibrosis. (A) Representative images of Masson staining, immunohistochemistry of α-SMA, Collagen-I and III, and
Sirius-Red staining by polarized light microscope; (B) Statistic results of Masson staining indicated as proportion of fibrotic area; (C, D) Statistic results of α-SMA, Collagen-I and III immunohistochemistry; (E) Statistic results of Sirius-Red staining indicated as area of collagen. Collagen I (red or yellow) and Collagen III (green) were marked in Sirius-Red staining. (F) The protein expression of α-SMA; (G) The mRNA expressions of Collagen I and III. Date are mean±S.E.M. n=8. **P < 0.01 vs. Control; #P < 0.05, ##P < 0.01 vs. ISO.

4. Effect of Xn on PTEN/AKT/mTOR signaling in ISO-treated mice. (A) Representative immunoblotting images of PTEN, p-AKT, AKT, p-mTOR, mTOR and GAPDH; (B-D) Gray value statistics of these proteins. Date are mean±S.E.M. n=8.

**P < 0.01 vs. Control; #P < 0.05, ##P < 0.01 vs. ISO.

 5. VO-ohpic reversed the regulative effect of Xn on PTEN/AKT/mTOR pathway in ISO-treated mice. (A) Representative immunoblotting images of PTEN, p-AKT, AKT, p-mTOR, mTOR and GAPDH; (B-D) Gray value statistics of these proteins. VO-ohpic: specific PTEN inhibitor. Date are mean±S.E.M. n=8. **P < 0.01 vs. ISO; ##P < 0.01 vs. ISO+Xn.

6. VO-ohpic reduced Xn-mediated inhibitory effect on ISO-induced cardiac dysfunction. (A) Representative M-mode echocardiography of left ventricular chamber; (B, C) Left ventricular ejection fraction (EF%) and left ventricular fractional shortening (FS%). (D, E) Levels of myocardial enzyme including CK and cTnT in plasma. Date are mean±S.E.M. n=8. **P < 0.01 vs. ISO; #P < 0.05, ##P < 0.01 vs.

ISO+Xn.

7. VO-ohpic reduced Xn-mediated inhibitory effect on ISO-induced cardiac hypertrophy. (A, B) Representative images of HE staining and WGA staining in myocardium; (C) heart weight/body weight ratio (HW/BW). Date are mean±S.E.M. n=8. *P < 0.05, **P < 0.01 vs. ISO; #P < 0.05, ##P < 0.01 vs. ISO+Xn.

. 8. VO-ohpic reduced Xn-mediated inhibitory effect on ISO-induced cardiac fibrosis. (A) Representative images of Masson staining, immunohistochemistry of
α-SMA, Collagen-I and III, and Sirius-Red staining by polarized light microscope; (B) Statistic results of Masson staining indicated as proportion of fibrotic area; (C, D) Statistic results of α-SMA, Collagen-I and III immunohistochemistry; (E) Statistic results of Sirius-Red staining indicated as area of collagen; (F, G) The protein expression of α-SMA. Date are mean±S.E.M. n=8. **P < 0.01 vs. ISO; #P < 0.05, ##P
< 0.01 vs. ISO+Xn.

9. Summary scheme of mechanism underlying the protective effect of Xn against ISO-induced cardiac hypertrophy and fibrosis. The cardioprotective effect of Xn was mediated by up-regulating PTEN leading to AKT/mTOR inactivation.

Supplementary 1. Effect of Xn on VO-Ohpic PTEN mRNA expression in ISO-treated mice