We used the following primer set to detect floxed

exon4: 5′ ATAGGCAGGTGGATCTCTGCG 3′ and 5′ AAATGACTGATGCTGCTC 3′. The following antibodies and reagents were obtained from BD Biosciences: FITC, PE, allophycocyanin, PE-Cy5-conjugated antimouse antibodies: CD3, CD4, CD8, CD44, CD62L, CD25, V-alpha2, TCR-β, CT99021 CD69, CD11b, TCR-γ-δ, B220, streptavidin-alkaline phosphatase, ELISPOT IL-2 Pair Set Abs. Primary antimouse Abs: Dlg1 (Sap97) was from Enzo Life Sciences, Dlg2 (PSD93) and Dlg4 (PSD95) were purchased from Millipore, and Dlg3 (Sap102) was from Synaptic Systems. Mouse anti-ERK2 was from Santa Cruz Biotechnology. Secondary Abs: goat antimouse IgG, and ECL HRP-linked donkey antirabbit IgG were purchased from Invitrogen and GE Healthcare Ltd., respectively. Thymocytes from KO and WT mice were lysed in Trizol (Invitrogen) and RNA was extracted according to instructions provided by the manufacturer. cDNA was synthesized directly from RNA using SuperScript III First-Strand Synthesis System (Invitrogen)

for RT-PCR according to manufacturer directions. Real-time PCR was performed on MX300P cycler (Strategene). The verified sequence of primers for each Dlg isoform from the Harvard Primer Bank database were as follows: Dlg1: selleck compound 5′ CGAAGAGTCACGTCGTTTTGA 3′ and 5′ TCTCCAAAGCGGAAGTTCAGT 3′; Dlg2: 5′ CTCAGGGACTCGGGTACAGTT 3′ and 5′ TGGGGGCTTTTCCGTACAC 3′; Dlg3: 5′ ACATTCTGCACGTCATTAACGC 3′ and 5′ ATGTCACTCCCTTCAGGTTCT 3′; Dlg4: 5′ TGAGATCAGTCATAGCAGCTACT 3′ and 5′ CTTCCTCCCCTAGCAGGTCC 3′. For protein analysis, cells from the thymus or brain were lysed on ice with RIPA buffer (50 mM Tris-HCl, 1% NP-40, 150 mM NaCl, 1 mM EDTA, and protease and phosphatase inhibitors) followed by protein concentration measurement with bicinchoninic acid (BCA) protein assay (Thermo Scientific). Equal amounts (100 μg) of lysate from the mouse brain, or mouse control and KO were separated on 8% SDS polyacrylamide

gels and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore) by electroblotting. Membranes were next blocked with 1% ovalbumin, and 0.02% sodium azide in PBS for 1 h at room temperature. Subsequently, membranes were incubated overnight at 4°C with one of the following antimouse primary Abs (diluted 1:1000): Dlg1 (Sap97), Dlg2 (PSD93), Dlg3 (Sap103), Dlg4 (PSD95), or Erk2 (diluted Digestive enzyme 1:2000 and used as a loading control). After incubation, blots were extensively washed and next incubated with appropriate HRP-conjugated secondary antibodies at the concentrations recommended by the manufacturer. The blots were developed by the chemiluminescence detection system (ECL Plus Western Blot Detection System from Amersham) according to the manufacturer’s instructions. Finally, blots were analyzed with ImageJ software (National Institute of Health, USA). For adoptive transfer to the thymus, the experiments were performed as previously described [26, 27] with minor modifications.